View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_71 (Length: 266)
Name: NF0243_low_71
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0243_low_71 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 25 - 195
Target Start/End: Original strand, 53112360 - 53112530
Alignment:
Q |
25 |
aggtatataggctacactnnnnnnntgagagcataagaacgattatcgtatcggtgacaatagtctgtttctattcaaaaacattttcagaatggacttt |
124 |
Q |
|
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53112360 |
aggtatataggctacactaaaaaaatgagaacataagaacgattatcgtatcggtgacaatagtctgtttctattcaaaaacattttcagaatggacttt |
53112459 |
T |
 |
Q |
125 |
ttggtctgttactatatatcaaaatagcaacgtaacatacctcacatcagccataacctggactttgaagg |
195 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53112460 |
ttggtctgttactatatatcaaaatagcaacgtaacatacctcacatcagccataacctggactttgaagg |
53112530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University