View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_77 (Length: 258)
Name: NF0243_low_77
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_low_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 125 - 220
Target Start/End: Complemental strand, 47699998 - 47699903
Alignment:
| Q |
125 |
taattaggtttctacggttattgatcccatcaaatatatcttatagaagttatgatctttgtctttgcaattcctactctatgttgtttgttttct |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
47699998 |
taattaggtttctacggttattgatcccatcaaatatatcttatagaagttattatctttgtcttcgcaattcctactctatgctgtttgttttct |
47699903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 4 - 106
Target Start/End: Original strand, 54426538 - 54426640
Alignment:
| Q |
4 |
gggattgttccagatgattatctaaatacttgtccgcaagatggcgattccgaagctgctgccattgccaattcttttcctcatctggagtggttagaga |
103 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||| ||||| ||||||||||| ||||| |||||| | |||||||| ||| || |||||| |
|
|
| T |
54426538 |
gggattgttcccgatgattatctaaatgcttgtccgcaagatggagattctgaagctgctgctattgctaattctatgcctcatctagaggggctagaga |
54426637 |
T |
|
| Q |
104 |
tta |
106 |
Q |
| |
|
||| |
|
|
| T |
54426638 |
tta |
54426640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 115 - 232
Target Start/End: Original strand, 54426960 - 54427077
Alignment:
| Q |
115 |
gtgcatatcttaattaggtttctacggttattgatcccatcaaatatatcttatagaagttatgatctttgtctttgcaattcctactctatgttgtttg |
214 |
Q |
| |
|
||||| ||||||||| |||||| |||||||||||| |||| |||||||||||||||| ||||||||||||||| ||||| || ||||||||||||| |
|
|
| T |
54426960 |
gtgcagatcttaattgcatttctatggttattgatccacacaaacatatcttatagaagttgtgatctttgtctttgtaattcatattctatgttgtttg |
54427059 |
T |
|
| Q |
215 |
ttttctttgtatgtgtaa |
232 |
Q |
| |
|
||||| |||||| ||||| |
|
|
| T |
54427060 |
ttttccttgtatctgtaa |
54427077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 36 - 106
Target Start/End: Complemental strand, 54429595 - 54429525
Alignment:
| Q |
36 |
tccgcaagatggcgattccgaagctgctgccattgccaattcttttcctcatctggagtggttagagatta |
106 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| ||||| |||||| | |||||||| |||||||||||||||| |
|
|
| T |
54429595 |
tccgcaagatggagattctgaagctgctgctattgctaattctatgcctcatctagagtggttagagatta |
54429525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2438 times since January 2019
Visitors: 2401