View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_80 (Length: 256)
Name: NF0243_low_80
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_low_80 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 35 - 239
Target Start/End: Complemental strand, 36759500 - 36759296
Alignment:
| Q |
35 |
cctatgagttatgattctcccttggttcttctcccacagtacagtgcaacaattttcattttaacgtttttactataataacannnnnnnacagaaaaat |
134 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36759500 |
cctatgagttatgattctccgttggttcttctcccacagtacagtgcaacaattttcattttaacgtttttactataataacatttttttacagaaaaat |
36759401 |
T |
 |
| Q |
135 |
taataatataatagcattttactataacagtaccacctccgacagtagcttttttacaggtaaaagaatttgctacactattggagataatccaagtatt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36759400 |
taataatataatagcattttactataacagtaccacctccgacagtagcttttttacaggtaaaagaatttgctacactattggagataatccaagtatt |
36759301 |
T |
 |
| Q |
235 |
tctct |
239 |
Q |
| |
|
||||| |
|
|
| T |
36759300 |
tctct |
36759296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University