View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_85 (Length: 251)
Name: NF0243_low_85
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_low_85 |
 | |
|
| [»] scaffold0045 (3 HSPs) |
| |
|
| [»] scaffold0457 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0045 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 87 - 251
Target Start/End: Complemental strand, 25426 - 25262
Alignment:
| Q |
87 |
aagttgatatatatccagcagctactagagagacaatgttgtctacaacttctttgtcactcaatttgtcaccatcatcatcttcaatttgcatcaaccc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25426 |
aagttgatatatatccagcagctactagagagacaatgttgtctacaacttctttgtcactcaatttgtcaccatcatcatcttcaatttgcatcaaccc |
25327 |
T |
|
| Q |
187 |
atccattagatcaattgtttccaccttatctttattctttctgttatctaattccatcccgaaaa |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25326 |
atccattagatcaattgtttccaccttatctttattctttctgttatctaattccatcccgaaaa |
25262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 95 - 245
Target Start/End: Complemental strand, 32628 - 32478
Alignment:
| Q |
95 |
atatatccagcagctactagagagacaatgttgtctacaacttctttgtcactcaatttgtcaccatcatcatcttcaatttgcatcaacccatccatta |
194 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
32628 |
atatatccagcagccactagagagacaatgttgtctacaacttctttgtcactcaatttatcaccttcaccatcttcaatttgcatcaacccatccatta |
32529 |
T |
|
| Q |
195 |
gatcaattgtttccaccttatctttattctttctgttatctaattccatcc |
245 |
Q |
| |
|
||||| ||||||| ||||||| || | ||||| || ||||||||||||| |
|
|
| T |
32528 |
gatcacttgtttcaaccttattttcagcttttcttttctctaattccatcc |
32478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #3
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 110 - 245
Target Start/End: Complemental strand, 40000 - 39862
Alignment:
| Q |
110 |
actagagagacaatgttgtctacaacttctttgtcactcaatttgtcaccatcatcatcttcaatttgcatcaacccatccattagatcaattg---ttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
40000 |
actagagagacaatgttgtctacaacttctttgtcactcaatttatcaccttcaccatcttcaatttgcatcaacccatccattagatcacttgtacttt |
39901 |
T |
|
| Q |
207 |
ccaccttatctttattctttctgttatctaattccatcc |
245 |
Q |
| |
|
|||||||| || ||||||||| ||| |||| ||||||| |
|
|
| T |
39900 |
tcaccttattttcattctttcttttacctaactccatcc |
39862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0457 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: scaffold0457
Description:
Target: scaffold0457; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 87 - 251
Target Start/End: Original strand, 4798 - 4962
Alignment:
| Q |
87 |
aagttgatatatatccagcagctactagagagacaatgttgtctacaacttctttgtcactcaatttgtcaccatcatcatcttcaatttgcatcaaccc |
186 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4798 |
aagttgatagatatccagcagctactagagagacaatgttgtctacaacttctttgtcactcaatttgtcaccatcatcatcttcaatttgcatcaaccc |
4897 |
T |
|
| Q |
187 |
atccattagatcaattgtttccaccttatctttattctttctgttatctaattccatcccgaaaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||| ||||| |
|
|
| T |
4898 |
atccattagatcaattgtttccaccttatctttattttttctgttatctatttcaatccagaaaa |
4962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2232 times since January 2019
Visitors: 2399