View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0244_high_10 (Length: 322)
Name: NF0244_high_10
Description: NF0244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0244_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 29 - 225
Target Start/End: Complemental strand, 6635897 - 6635701
Alignment:
Q |
29 |
atcatcaatgatcaattcaaagaagcccctcaattctacaactcaccaaattgtgcctccatcactgagccagaagaagacaccgaacatgacactgaca |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
6635897 |
atcatcaatgatcaattcaaagaagcccctcaattctacaactcaccaaattgtgcctccatcactgagccagaagaagacaccgaacatgacactggca |
6635798 |
T |
 |
Q |
129 |
catatatctgctccgaggaagcagtccatgtggcaatgacattagacacgacatatatccgaggatccatggctgcaatcctctctgtcctccaaca |
225 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6635797 |
catatatctgctccgaggaagcagtccatgtggcaatgacattagacacaacatatatccgaggatccatggctgcaatcctctctgtcctccaaca |
6635701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 151 - 226
Target Start/End: Complemental strand, 52164667 - 52164592
Alignment:
Q |
151 |
agtccatgtggcaatgacattagacacgacatatatccgaggatccatggctgcaatcctctctgtcctccaacat |
226 |
Q |
|
|
|||||| || ||||||||| | ||||| ||||||||||||||||||||||| |||||| | || ||||||||||| |
|
|
T |
52164667 |
agtccaagtagcaatgacactcgacacaacatatatccgaggatccatggcagcaatcttatcaatcctccaacat |
52164592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2501 times since January 2019
Visitors: 2401