View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0244_high_7 (Length: 376)
Name: NF0244_high_7
Description: NF0244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0244_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 145 - 351
Target Start/End: Complemental strand, 28521914 - 28521709
Alignment:
| Q |
145 |
agaagggagtcttggaatattttaagaatgttagcacgacaatcaaatattccatggtgtattgtgggcgtttttaattatatctttgtcaaatgatgat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
28521914 |
agaagggagtcttggaatattttaagaatgttagcacgacaatcgaatattccatggtgtattgtgggcgtatttaatgatatctt-gtcaaatgatgat |
28521816 |
T |
|
| Q |
245 |
aaaaaagggagtgttccccacccttaatggctcttcaatggtttccgggaagtagtaagtgattgtgaattcatcgatgttcctctacaaggacatgcat |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28521815 |
aaaaaagggagtgttccccacccttaatggctcttcaatggtttccaggaagtagtaagtgattgtgaattcatcgatgttcatctacaaggacatgcat |
28521716 |
T |
|
| Q |
345 |
atacatc |
351 |
Q |
| |
|
||||||| |
|
|
| T |
28521715 |
atacatc |
28521709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 12 - 132
Target Start/End: Complemental strand, 28522073 - 28521954
Alignment:
| Q |
12 |
gaagtggaagtctagctatgctttggaaacatatgagaggttttgtgagattcaaaattattctcgtaattttataaatatcatagtcaaggaggatgat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28522073 |
gaagtggaagtctagctatgctttggaa-catatgagaggttttgtgagattcaaaattattctcgtaattttataaatatcatagtcaaggaggatgat |
28521975 |
T |
|
| Q |
112 |
aacggtatagaatggaggcta |
132 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28521974 |
aacggtatagaatggaggcta |
28521954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 146 - 214
Target Start/End: Original strand, 19519398 - 19519466
Alignment:
| Q |
146 |
gaagggagtcttggaatattttaagaatgttagcacgacaatcaaatattccatggtgtattgtgggcg |
214 |
Q |
| |
|
|||| |||||| ||||||| ||||||||||||||| |||||| | | |||||||||||||||| |||| |
|
|
| T |
19519398 |
gaagagagtctgagaatattgtaagaatgttagcaccacaatctactcttccatggtgtattgttggcg |
19519466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2407 times since January 2019
Visitors: 2400