View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0244_low_10 (Length: 325)
Name: NF0244_low_10
Description: NF0244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0244_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 95 - 314
Target Start/End: Complemental strand, 25006050 - 25005835
Alignment:
| Q |
95 |
atttaatctgtgtgtttttgtacatggaccagttcaacaaatatttggaggctccttttcatgatgtttatatatagttcacttttagttgtttatcatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25006050 |
atttaatctgtgtgtttttgtacatggaccagttcaacaaatatttggaggctcctttacatgatgtttata----gttcacttttagttgtttatcatt |
25005955 |
T |
 |
| Q |
195 |
attattttgatcatggtgcagaggaacaaagactcagttttggaatagaaaactctagcacttgatatagatgatgagcttgagatataaacatttgatt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25005954 |
attattttgatcatggtgcagaggaacaaagactcagttttggaatagaaaactctaccacttgatatagatgatgagcttgagatataaacatttgatt |
25005855 |
T |
 |
| Q |
295 |
catcagacacttattttcat |
314 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25005854 |
catcagacacttattttcat |
25005835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 29 - 94
Target Start/End: Complemental strand, 25006431 - 25006366
Alignment:
| Q |
29 |
agtattaagatagactttgaatcatctcgacaatttggaggctttcagtgttgttctgcggcgaat |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
25006431 |
agtattaagatagactttgaatcatctcgacaatttggaggctttcggtgttgttctgcagcgaat |
25006366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University