View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0245-INSERTION-14 (Length: 328)
Name: NF0245-INSERTION-14
Description: NF0245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0245-INSERTION-14 |
 |  |
|
[»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-169; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 21 - 328
Target Start/End: Original strand, 48702552 - 48702859
Alignment:
Q |
21 |
aattcttgagctctggcactactgcagtctctataagattcccctcagcattgttcttattcttgcagccaagaaggataggaatgacatctaacaacag |
120 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48702552 |
aattcttgagctctggcactattgcagtctctataagattcccctcagcattgttcttattcttgcagccaagaaggataggaatgacatctaacaacag |
48702651 |
T |
 |
Q |
121 |
ttcatcattgcctgccagcacccttagagttgtctgccattcattattgaattgaaggaaaataaagttagaatgaagtttgaaatattttatctacaca |
220 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48702652 |
ttcatcattgcctgccagcacccttagagttgtctgccattcattattgaattgaaggaaaataaagttagaatgaagtttgaaatattttatctacaca |
48702751 |
T |
 |
Q |
221 |
gtatgatatgaaccataaacatgaatagaatacctgaaaaaccaaactactagattggtcaagttgaagggacttgatgtattttgtagcatggttgaac |
320 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48702752 |
gtatgatatgaaccataaacatgaatagaatacctgaaaaaccaaactactaaattggtcaagttgaagggacttgatgtattttgtagcatggttgaac |
48702851 |
T |
 |
Q |
321 |
atctgaga |
328 |
Q |
|
|
|||||||| |
|
|
T |
48702852 |
atctgaga |
48702859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 29931997 - 29931936
Alignment:
Q |
49 |
ctctataagattcccctcagcattgttcttattcttgcagccaagaaggataggaatgacat |
110 |
Q |
|
|
|||||||| ||||||||| |||| |||| ||||||||||||||||||||||| |||||||| |
|
|
T |
29931997 |
ctctataaaattcccctctacattattctcattcttgcagccaagaaggatagaaatgacat |
29931936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 73 - 116
Target Start/End: Complemental strand, 15539247 - 15539204
Alignment:
Q |
73 |
gttcttattcttgcagccaagaaggataggaatgacatctaaca |
116 |
Q |
|
|
||||||||||||||| ||||||| |||||||||| ||||||||| |
|
|
T |
15539247 |
gttcttattcttgcaaccaagaaagataggaatgtcatctaaca |
15539204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2417 times since January 2019
Visitors: 2400