View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0245-INSERTION-17 (Length: 333)
Name: NF0245-INSERTION-17
Description: NF0245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0245-INSERTION-17 |
 |  |
|
[»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 161 - 333
Target Start/End: Complemental strand, 47428261 - 47428089
Alignment:
Q |
161 |
gaatttgtgaaaaaagctgctacgaagattcaagcttcctttcgctcctacttggtataaacttctctctatatttcattacattttaaaaaatgtgatc |
260 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47428261 |
gaatttgtgaaaaaagctgctacaaagattcaagcttcctttcgctcctacttggtataaacttctctctatatttcattacattttaaaaaatgtgatc |
47428162 |
T |
 |
Q |
261 |
gcatgtgttggtgtcacacaccggacatgtcttctcgatctcaagtgtatgtgatacaaagtttatgctataa |
333 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47428161 |
gcatgtgttggtgtcacacaccggacatgtcttctcgatctcaagtgtatgtgatacaaagtttatgctataa |
47428089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 7 - 165
Target Start/End: Complemental strand, 47428089 - 47427931
Alignment:
Q |
7 |
acatacatacaaaatttgcaggcaaggagagcattgcatgctttaaagggattggtgaagttacaggcactagtgaggggtcaccttgtaaggaaacaaa |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47428089 |
acatacatacaaaatttgcaggcaaggagagcattgcatgctttaaagggattggtgaagttacaggcactagtgaggggtcaccttgtaaggaaacaaa |
47427990 |
T |
 |
Q |
107 |
caactgcaacactacgcggaatgcatgcattgatgtcgatacaagttagagcacgaatt |
165 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47427989 |
caactgcaacactacgtggaatgcatgcattgatgtcgatacaagttagagcacgaatt |
47427931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University