View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0245-INSERTION-18 (Length: 79)
Name: NF0245-INSERTION-18
Description: NF0245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0245-INSERTION-18 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 1e-37
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 47529085 - 47529163
Alignment:
| Q |
1 |
caccccagcaggtgggaacaagataggacgaacaaattccctgccacgggtggctagcttggaacatcttcagagtcga |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47529085 |
caccccagcaggtgggaacaagataggacgaacaaattccctgccacgggtggctagcttggaacatcttcagagtcga |
47529163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 74
Target Start/End: Complemental strand, 36006468 - 36006441
Alignment:
| Q |
47 |
cgggtggctagcttggaacatcttcaga |
74 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
36006468 |
cgggtggctagcttggaacatcttcaga |
36006441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University