View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0245-INSERTION-18 (Length: 79)

Name: NF0245-INSERTION-18
Description: NF0245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0245-INSERTION-18
NF0245-INSERTION-18
[»] chr7 (1 HSPs)
chr7 (1-79)||(47529085-47529163)
[»] chr1 (1 HSPs)
chr1 (47-74)||(36006441-36006468)


Alignment Details
Target: chr7 (Bit Score: 79; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 1e-37
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 47529085 - 47529163
Alignment:
1 caccccagcaggtgggaacaagataggacgaacaaattccctgccacgggtggctagcttggaacatcttcagagtcga 79  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47529085 caccccagcaggtgggaacaagataggacgaacaaattccctgccacgggtggctagcttggaacatcttcagagtcga 47529163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 74
Target Start/End: Complemental strand, 36006468 - 36006441
Alignment:
47 cgggtggctagcttggaacatcttcaga 74  Q
    ||||||||||||||||||||||||||||    
36006468 cgggtggctagcttggaacatcttcaga 36006441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University