View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0245-INSERTION-19 (Length: 87)
Name: NF0245-INSERTION-19
Description: NF0245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0245-INSERTION-19 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 2e-39
Query Start/End: Original strand, 2 - 87
Target Start/End: Original strand, 38874301 - 38874386
Alignment:
Q |
2 |
aggtactcgctcactcttcgctgcttcaaaaccattcagagttaattttgttgcaatgcaggttattgaagccgttgattcattga |
87 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38874301 |
aggtactcgctcattcttcgctgcttcaaaaccattcagagttaattttgttgcaatgcaggttattgaagccgttgattcattga |
38874386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University