View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0245-INSERTION-23 (Length: 249)

Name: NF0245-INSERTION-23
Description: NF0245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0245-INSERTION-23
NF0245-INSERTION-23
[»] chr5 (1 HSPs)
chr5 (13-245)||(28505544-28505776)
[»] chr3 (1 HSPs)
chr3 (18-93)||(51875061-51875136)


Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 245
Target Start/End: Complemental strand, 28505776 - 28505544
Alignment:
13 aattgcttcaatgggaatacttattcaaacaacatctttggtttatgtttttccatcatcacttagtcttggtgtttcaacaagaataggaaatgagtta 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28505776 aattgcttcaatgggaatacttattcaaacaacatctttggtttatgtttttccatcatcacttagtcttggtgtttcaacaagaataggaaatgagtta 28505677  T
113 ggtgcaaataggccacaaaaagcaagaatttcaatgattgtttcactttttcttgctatggttttaggacttggagcaatgctattcacaactttgatga 212  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28505676 ggtgcaaataggccacaaaaagcaagaatttcaatgatagtttcactttttcttgctatggttttaggacttggagcaatgctattcacaactttgatga 28505577  T
213 gaaaccaatggggaaagtttttcacaaatgaca 245  Q
    |||||||||||||||||||||||||||||||||    
28505576 gaaaccaatggggaaagtttttcacaaatgaca 28505544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 18 - 93
Target Start/End: Original strand, 51875061 - 51875136
Alignment:
18 cttcaatgggaatacttattcaaacaacatctttggtttatgtttttccatcatcacttagtcttggtgtttcaac 93  Q
    |||||||||| || |||||||||||||| ||||||||||||||||||||||| || |||||| |||||||||||||    
51875061 cttcaatgggtattcttattcaaacaacttctttggtttatgtttttccatcttctcttagttttggtgtttcaac 51875136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University