View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0245-INSERTION-23 (Length: 249)
Name: NF0245-INSERTION-23
Description: NF0245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0245-INSERTION-23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 245
Target Start/End: Complemental strand, 28505776 - 28505544
Alignment:
| Q |
13 |
aattgcttcaatgggaatacttattcaaacaacatctttggtttatgtttttccatcatcacttagtcttggtgtttcaacaagaataggaaatgagtta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28505776 |
aattgcttcaatgggaatacttattcaaacaacatctttggtttatgtttttccatcatcacttagtcttggtgtttcaacaagaataggaaatgagtta |
28505677 |
T |
|
| Q |
113 |
ggtgcaaataggccacaaaaagcaagaatttcaatgattgtttcactttttcttgctatggttttaggacttggagcaatgctattcacaactttgatga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28505676 |
ggtgcaaataggccacaaaaagcaagaatttcaatgatagtttcactttttcttgctatggttttaggacttggagcaatgctattcacaactttgatga |
28505577 |
T |
|
| Q |
213 |
gaaaccaatggggaaagtttttcacaaatgaca |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28505576 |
gaaaccaatggggaaagtttttcacaaatgaca |
28505544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 18 - 93
Target Start/End: Original strand, 51875061 - 51875136
Alignment:
| Q |
18 |
cttcaatgggaatacttattcaaacaacatctttggtttatgtttttccatcatcacttagtcttggtgtttcaac |
93 |
Q |
| |
|
|||||||||| || |||||||||||||| ||||||||||||||||||||||| || |||||| ||||||||||||| |
|
|
| T |
51875061 |
cttcaatgggtattcttattcaaacaacttctttggtttatgtttttccatcttctcttagttttggtgtttcaac |
51875136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1869 times since January 2019
Visitors: 2394