View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0245-INSERTION-24 (Length: 261)
Name: NF0245-INSERTION-24
Description: NF0245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0245-INSERTION-24 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 102 - 261
Target Start/End: Original strand, 3683055 - 3683214
Alignment:
| Q |
102 |
gaattctcccccatgagaggttgtttggctggttccatttgcatattcaaactgcaagaggagccgaaaaaggaatcaaccaagcttcatcctccctctc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3683055 |
gaattctcccccatgagaggttgtttggctggttccatttgcatcttcaaactgcaagaggagccgaaaaaggaatcaaccaagcttcatcctccctctc |
3683154 |
T |
|
| Q |
202 |
acggcggaggagaaaaggtggtggcagccggcaactattggtggtagtggttgttgcaac |
261 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
3683155 |
acggcggaggagaaaaggtggtggtagccagcaactattggtggtagtggttgttgcaac |
3683214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 99
Target Start/End: Original strand, 3683235 - 3683299
Alignment:
| Q |
35 |
gtttacggtcgcgattgcatttgattgaaaattctaatatcaaagattcagacgcgaccgtgatc |
99 |
Q |
| |
|
||||||||||||||||| |||| ||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3683235 |
gtttacggtcgcgattgtatttaattaaaaattctaatattaaagattcagacgcgaccgtgatc |
3683299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2419 times since January 2019
Visitors: 2400