View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0245-INSERTION-25 (Length: 55)
Name: NF0245-INSERTION-25
Description: NF0245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0245-INSERTION-25 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 2 - 55
Target Start/End: Complemental strand, 29252302 - 29252249
Alignment:
| Q |
2 |
ataatgacactcttttgagtggattcacaattaagctcgagatacatcttcaag |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29252302 |
ataatgacactcttttgagtggattcacaattaagctcgagatacatgttcaag |
29252249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 3 - 53
Target Start/End: Original strand, 40123145 - 40123195
Alignment:
| Q |
3 |
taatgacactcttttgagtggattcacaattaagctcgagatacatcttca |
53 |
Q |
| |
|
||||||||| ||| |||||||||| ||||||||||||||||| ||| |||| |
|
|
| T |
40123145 |
taatgacacccttatgagtggatttacaattaagctcgagattcatgttca |
40123195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University