View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0245_high_1 (Length: 432)
Name: NF0245_high_1
Description: NF0245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0245_high_1 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 411; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 411; E-Value: 0
Query Start/End: Original strand, 22 - 432
Target Start/End: Original strand, 5695538 - 5695948
Alignment:
Q |
22 |
catcatcacttagaattgaggactgcctagtatttgcatacatcatattggctgttctcttgtctattgtggcctatgactatcaggtgcagttgttatt |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5695538 |
catcatcacttagaattgaggactgcctagtatttgcatacatcatattggctgttctcttgtctattgtggcctatgactatcaggtgcagttgttatt |
5695637 |
T |
 |
Q |
122 |
gtctttaaaaagtctcaaatatacttttggtcagattttcaatcttgaagtctacatttgactcatcaatttttcatgtgcaggaaattggagttcttgt |
221 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5695638 |
gtctttaaaaagtctcaaatatacttttggtcagattttcaatcttgaagtctacatttgactcatcaatttttcatgtgcaggaaattggagttcttgt |
5695737 |
T |
 |
Q |
222 |
gacactttttagcttgtttcatgcttgtgttggcttcgttttaccatcacttgctagattgaggaccatgtaatctcattacaaagagttgtacttcttt |
321 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5695738 |
gacactttttagcttgtttcatgcttgtgttggcttcgttttaccatcacttgctagattgaggaccatgtaatctcattacaaagagttgtacttcttt |
5695837 |
T |
 |
Q |
322 |
gtttgctcaataatggatttatatttttaatttccttgtttgcaggtatgtacctaatgaattgcgtggagggatgatggggctctctcttgcccctgca |
421 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5695838 |
gtttgctcaataatggatttatatttttaatttccttgtttgcaggtatgtacctaatgaattgcgtggagggatgatggggctctctcttgcccctgca |
5695937 |
T |
 |
Q |
422 |
aatgctgcaat |
432 |
Q |
|
|
||||||||||| |
|
|
T |
5695938 |
aatgctgcaat |
5695948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2131 times since January 2019
Visitors: 2399