View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0245_low_3 (Length: 297)
Name: NF0245_low_3
Description: NF0245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0245_low_3 |
 |  |
|
[»] scaffold0171 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0171 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 124 - 222
Target Start/End: Complemental strand, 11160 - 11062
Alignment:
Q |
124 |
atatggaagttaggaaaattgcttacaacgatgaaactcgtgacattctccttgtttaacttgatcccaatctcagtgttattgttctcatgaatttcc |
222 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11160 |
atatggaagttaggagaattgcttacaacgatgaaactcgtgacattctccttgtttaacttgatcccaatctcagtgttattgttctcatgaatttcc |
11062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2065 times since January 2019
Visitors: 2396