View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0246_high_11 (Length: 260)
Name: NF0246_high_11
Description: NF0246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0246_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 191 - 252
Target Start/End: Complemental strand, 47074746 - 47074685
Alignment:
Q |
191 |
gagaaggtattcattggtccctgaaatcgaatttgtgttatattttggatttgatctctgct |
252 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47074746 |
gagaaggtattcattggtccctgaaatcgaatttgtgttatattttggatttgatctctgct |
47074685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 23 - 58
Target Start/End: Complemental strand, 41531905 - 41531870
Alignment:
Q |
23 |
atcatcatactggatatcaaacatcaatgttaaaga |
58 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
41531905 |
atcatcatactggatatcaaacatcaatgttaaaga |
41531870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2835 times since January 2019
Visitors: 2404