View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0246_high_3 (Length: 399)
Name: NF0246_high_3
Description: NF0246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0246_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 6e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 197 - 301
Target Start/End: Original strand, 47074685 - 47074789
Alignment:
| Q |
197 |
agcagagatcaaatccaaaatataacacaaattcgatttcagggaccaatgaataccttctcttgtccattgcgtgttgatcgcatgacaaaatttgcgc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47074685 |
agcagagatcaaatccaaaatataacacaaattcgatttcagggaccaatgaataccttctcttgtccattgcgtgtggatcgcatgacaaaatttgcgc |
47074784 |
T |
|
| Q |
297 |
ctttt |
301 |
Q |
| |
|
||||| |
|
|
| T |
47074785 |
ctttt |
47074789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 243 - 291
Target Start/End: Original strand, 47056763 - 47056811
Alignment:
| Q |
243 |
caatgaataccttctcttgtccattgcgtgttgatcgcatgacaaaatt |
291 |
Q |
| |
|
||||||| |||||||||||||| |||||| | ||| ||||||||||||| |
|
|
| T |
47056763 |
caatgaacaccttctcttgtcctttgcgtttggatggcatgacaaaatt |
47056811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 231 - 302
Target Start/End: Complemental strand, 18230687 - 18230616
Alignment:
| Q |
231 |
gatttcagggaccaatgaataccttctcttgtccattgcgtgttgatcgcatgacaaaatttgcgccttttt |
302 |
Q |
| |
|
|||| |||||| ||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
18230687 |
gattgcagggatcaatgaacaccttctcttgtccattgcgtgtggatggcatgacaaaatttgcgccttttt |
18230616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 3018983 - 3018923
Alignment:
| Q |
1 |
tcaacatattattataaattagtttaataaactaagatctagaattttgaatttaataata |
61 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3018983 |
tcaacatactactataaattagtttaataaactaagatctagaattttgaatttaagaata |
3018923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1874 times since January 2019
Visitors: 2394