View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0246_high_7 (Length: 318)

Name: NF0246_high_7
Description: NF0246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0246_high_7
NF0246_high_7
[»] chr3 (2 HSPs)
chr3 (9-174)||(35394029-35394194)
chr3 (196-232)||(35393962-35393998)


Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 9 - 174
Target Start/End: Complemental strand, 35394194 - 35394029
Alignment:
9 agcagagattggatgatgaaccataggttgtccagctaatggaaagagtggtttaggaatgttgaatgataatggacggaatcgagtgcctttggtgggt 108  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35394194 agcagagattggatgatgaaccattggttgtccagctaatggaaagagtggtttaggaatgttgaatgataatggacggaatcgagtgcctttggtgggt 35394095  T
109 cctccaaccatgataaccgccacaactctctcttctgcaatccccatcttattcgagatccacaat 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35394094 cctccaaccatgataaccgccacaactctctcttctgcaatccccatcttattcgagatccacaat 35394029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 196 - 232
Target Start/End: Complemental strand, 35393998 - 35393962
Alignment:
196 tgagtttcagaaattacaatgaggttgttgttgtgtt 232  Q
    |||||||||||||||||||||||||||||||||||||    
35393998 tgagtttcagaaattacaatgaggttgttgttgtgtt 35393962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University