View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0246_high_8 (Length: 293)
Name: NF0246_high_8
Description: NF0246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0246_high_8 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 23 - 293
Target Start/End: Complemental strand, 25794519 - 25794250
Alignment:
Q |
23 |
acacatttgaaatctggaatccgaacacccctcttgatattgtctttgtttnnnnnnnttatgatcatatggtcaagatggggagcaaaaagggagtgtt |
122 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25794519 |
acacatttgaaatctggaatccgaacacccctcttgatattgtctttgtttaaaaaaattatgatcatatggtcaagatggggagcaaaaagggagtgtt |
25794420 |
T |
 |
Q |
123 |
ggtccttattttgtaaattttttgtatcagctcttatattatagccaatcaaagagatttctgactcattgagaatttacaacagaatttacagataacc |
222 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25794419 |
ggtccttattttgtaaattttt-gtatcagctcttatattatagccaatcaaagagatttctgactcattgagaatttacaacagaatttacagataacc |
25794321 |
T |
 |
Q |
223 |
taccaagtatggaattttggactcaaacctaagttgtaatccgtatgagaggaaagtcttaccatgtgtgc |
293 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25794320 |
taccaagtatggaattttggactcaaacccaagttgtaatccgtatgagaggaaagtcttaccatgtgtgc |
25794250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University