View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0246_low_11 (Length: 260)

Name: NF0246_low_11
Description: NF0246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0246_low_11
NF0246_low_11
[»] chr7 (1 HSPs)
chr7 (191-252)||(47074685-47074746)
[»] chr5 (1 HSPs)
chr5 (23-58)||(41531870-41531905)


Alignment Details
Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 191 - 252
Target Start/End: Complemental strand, 47074746 - 47074685
Alignment:
191 gagaaggtattcattggtccctgaaatcgaatttgtgttatattttggatttgatctctgct 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47074746 gagaaggtattcattggtccctgaaatcgaatttgtgttatattttggatttgatctctgct 47074685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 23 - 58
Target Start/End: Complemental strand, 41531905 - 41531870
Alignment:
23 atcatcatactggatatcaaacatcaatgttaaaga 58  Q
    ||||||||||||||||||||||||||||||||||||    
41531905 atcatcatactggatatcaaacatcaatgttaaaga 41531870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University