View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0246_low_5 (Length: 362)
Name: NF0246_low_5
Description: NF0246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0246_low_5 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 13 - 362
Target Start/End: Complemental strand, 25794598 - 25794250
Alignment:
Q |
13 |
aaaatgcctctcgattttcggattttagaatccgtcaagggaaaaatttagccacggtatctgttttttcagaatctttacacatttgaaatctggaatc |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25794598 |
aaaatgcctctcgattttcggattttagaatccgtcaagggaaaaaattagccacggtatctgttttttcagaatctttacacatttgaaatctggaatc |
25794499 |
T |
 |
Q |
113 |
cgaacacccctcttgatattgtctttgtttnnnnnnnttatgatcatatggtcaagatggggagcaaaaagggagtgttggtccttattttgtaaatttt |
212 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25794498 |
cgaacacccctcttgatattgtctttgtttaaaaaaattatgatcatatggtcaagatggggagcaaaaagggagtgttggtccttattttgtaaatttt |
25794399 |
T |
 |
Q |
213 |
ttgtatcagctcttatattatagccaatcaaagagatttctgactcattgagaatttacaacagaatttacagataacctaccaagtatggaattttgga |
312 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25794398 |
t-gtatcagctcttatattatagccaatcaaagagatttctgactcattgagaatttacaacagaatttacagataacctaccaagtatggaattttgga |
25794300 |
T |
 |
Q |
313 |
ctcaaacctaagttgtaatccgtatgagaggaaagtcttaccatgtgtgc |
362 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25794299 |
ctcaaacccaagttgtaatccgtatgagaggaaagtcttaccatgtgtgc |
25794250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1504 times since January 2019
Visitors: 2391