View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0246_low_6 (Length: 362)
Name: NF0246_low_6
Description: NF0246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0246_low_6 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 16 - 362
Target Start/End: Complemental strand, 25794595 - 25794250
Alignment:
Q |
16 |
atgcctctcgattttcggattttagaatccgtcaagggaaaaatttagccacggtatctgttttttcagaatctttacacatttgaaatctggaatccga |
115 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25794595 |
atgcctctcgattttcggattttagaatccgtcaagggaaaaaattagccacggtatctgttttttcagaatctttacacatttgaaatctggaatccga |
25794496 |
T |
 |
Q |
116 |
acacccctcttgatattgtctttgtttnnnnnnnttatgatcatatggtcaagatggggagcaaaaagggagtgttggtccttattttgtaaattttttg |
215 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
25794495 |
acacccctcttgatattgtctttgtttaaaaaaattatgatcatatggtcaagatggggagcaaaaagggagtgttggtccttattttgtaaattttt-g |
25794397 |
T |
 |
Q |
216 |
tatcagctcttatattatagccaatcaaagagatttctgactcattgagaatttacaacagaatttacagataacctaccaagtatggaattttggactc |
315 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25794396 |
tatcagctcttatattatagccaatcaaagagatttctgactcattgagaatttacaacagaatttacagataacctaccaagtatggaattttggactc |
25794297 |
T |
 |
Q |
316 |
aaacctaagttgtaatccgtatgagaggaaagtcttaccatgtgtgc |
362 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25794296 |
aaacccaagttgtaatccgtatgagaggaaagtcttaccatgtgtgc |
25794250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University