View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0246_low_7 (Length: 318)
Name: NF0246_low_7
Description: NF0246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0246_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 9 - 174
Target Start/End: Complemental strand, 35394194 - 35394029
Alignment:
| Q |
9 |
agcagagattggatgatgaaccataggttgtccagctaatggaaagagtggtttaggaatgttgaatgataatggacggaatcgagtgcctttggtgggt |
108 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35394194 |
agcagagattggatgatgaaccattggttgtccagctaatggaaagagtggtttaggaatgttgaatgataatggacggaatcgagtgcctttggtgggt |
35394095 |
T |
 |
| Q |
109 |
cctccaaccatgataaccgccacaactctctcttctgcaatccccatcttattcgagatccacaat |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35394094 |
cctccaaccatgataaccgccacaactctctcttctgcaatccccatcttattcgagatccacaat |
35394029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 196 - 232
Target Start/End: Complemental strand, 35393998 - 35393962
Alignment:
| Q |
196 |
tgagtttcagaaattacaatgaggttgttgttgtgtt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35393998 |
tgagtttcagaaattacaatgaggttgttgttgtgtt |
35393962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University