View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0246_low_9 (Length: 266)

Name: NF0246_low_9
Description: NF0246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0246_low_9
NF0246_low_9
[»] chr2 (1 HSPs)
chr2 (40-223)||(10612255-10612438)
[»] chr4 (1 HSPs)
chr4 (40-105)||(30984643-30984707)


Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 40 - 223
Target Start/End: Complemental strand, 10612438 - 10612255
Alignment:
40 aaaataaaacacaataagcataaaatcaaatagtattgatgccaataatgaataaatatttcaacaactgcatcaatggagaaaacggctgcataattta 139  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |    
10612438 aaaataaaacacaataagcataaaatcaaatagtattgatgccaataatgaataaatatttcaacaactgcatcgatggagaaaacggctgcataattaa 10612339  T
140 aatttcttaatttatccagtgattgtttcatttcagcatgaaagtaaatnnnnnnncaatcacatggttgataaaataatgatg 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||    
10612338 aatttcttaatttatccagtgattgtttcatttcagcatgaaagtaaataaaaaaacaatcacatggttgataaaataatgatg 10612255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 30984707 - 30984643
Alignment:
40 aaaataaaacacaataagcataaaatcaaatagtattgatgccaataatgaataaatatttcaaca 105  Q
    |||||||||||  |||| ||||||||||| |||||| || || |||||||| ||||||||||||||    
30984707 aaaataaaacatgataaacataaaatcaagtagtatcga-gctaataatgattaaatatttcaaca 30984643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2106 times since January 2019
Visitors: 2396