View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0247_low_1 (Length: 314)
Name: NF0247_low_1
Description: NF0247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0247_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 81 - 291
Target Start/End: Original strand, 49082847 - 49083057
Alignment:
| Q |
81 |
acagattatcatgcctcctcaaaacataacatttccacagaataaactttatgttgctgcagnnnnnnntgctgcaagcaatcattctagtggttccgtg |
180 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
49082847 |
acagattaccatgcctcctcaaaatataacatttccacagaataaacttgatgttgctgcagaaaacaatgctgcaagcaatcattctagtggttctgtg |
49082946 |
T |
 |
| Q |
181 |
gcttccacacacaaaaatattgaatgcagtgnnnnnnntagtgagcctcatgtaagttttgcctatgcacgccatctaaatttcactgaagcagtgtaat |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49082947 |
gcttccacacacaaaaatattgaatgcagtgaaaaaaatagtgagcctcatgtaagttttgcctatgcacgccatctaaatttcactgaagcagtgtaat |
49083046 |
T |
 |
| Q |
281 |
aggattgttag |
291 |
Q |
| |
|
||||||||||| |
|
|
| T |
49083047 |
aggattgttag |
49083057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University