View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0247_low_2 (Length: 260)
Name: NF0247_low_2
Description: NF0247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0247_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 30 - 245
Target Start/End: Original strand, 213385 - 213602
Alignment:
| Q |
30 |
gaaaggtctctcatgttattgtgatatatctttatcttgcttaatttatgcttagtttggaataaacatttcagttagtacttattaacaaaagaaaaat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
213385 |
gaaaggtctctcatgttattgtgatatatctttatcttgcttaatttatgcttagtttggaataaacatttcagttagtacttattaacaaaagaaaaat |
213484 |
T |
 |
| Q |
130 |
ggaaatgctgttacattaactatgtgcttatctaatttttcaaaagctcttcatttac--nnnnnnnnnnnnncatatgcaactagcttttactgaaatc |
227 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
213485 |
ggaaatgttgttacattaactatgtgcttatctaatttttcaaaagctcttcatttactttttttttttttttcatatgcaactagcttttactgaaatc |
213584 |
T |
 |
| Q |
228 |
tggatctatttgacgcat |
245 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
213585 |
tggatctatttgacgcat |
213602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 240
Target Start/End: Original strand, 251896 - 251935
Alignment:
| Q |
201 |
catatgcaactagcttttactgaaatctggatctatttga |
240 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
251896 |
catatgcaattagcttttactgaaatctggatctatttga |
251935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 211 - 242
Target Start/End: Complemental strand, 234810 - 234779
Alignment:
| Q |
211 |
tagcttttactgaaatctggatctatttgacg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
234810 |
tagcttttactgaaatctggatctatttgacg |
234779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 240
Target Start/End: Complemental strand, 246493 - 246454
Alignment:
| Q |
201 |
catatgcaactagcttttactgaaatctggatctatttga |
240 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
246493 |
catatgcaattagcttttattgaaatctggatctatttga |
246454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University