View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0247_low_6 (Length: 237)
Name: NF0247_low_6
Description: NF0247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0247_low_6 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 90 - 237
Target Start/End: Original strand, 49082856 - 49083003
Alignment:
Q |
90 |
catgcctcctcaaaacataaaatttccacagaataaacttgatgttgctgcagaaaacaatgctgcaagcaatcattctagtggttccgtggcttccaca |
189 |
Q |
|
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
49082856 |
catgcctcctcaaaatataacatttccacagaataaacttgatgttgctgcagaaaacaatgctgcaagcaatcattctagtggttctgtggcttccaca |
49082955 |
T |
 |
Q |
190 |
cacaaaaatattgaatgcagtgnnnnnnntagtgagcctcatgtaagt |
237 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
49082956 |
cacaaaaatattgaatgcagtgaaaaaaatagtgagcctcatgtaagt |
49083003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University