View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0248_low_1 (Length: 623)
Name: NF0248_low_1
Description: NF0248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0248_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 1193829 - 1193790
Alignment:
| Q |
1 |
acaaaagaaacaggataatgcaagatttcttagattacta |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1193829 |
acaaaagaaacaggataatgcaagatttcttagattacta |
1193790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 381 - 423
Target Start/End: Original strand, 45635099 - 45635141
Alignment:
| Q |
381 |
gttgcaagagttggcagtgccatgttgatggttaaaaagaagc |
423 |
Q |
| |
|
|||||||| |||||||||||||||||||| | ||||||||||| |
|
|
| T |
45635099 |
gttgcaagggttggcagtgccatgttgattgctaaaaagaagc |
45635141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1406 times since January 2019
Visitors: 2391