View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0248_low_1 (Length: 623)

Name: NF0248_low_1
Description: NF0248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0248_low_1
NF0248_low_1
[»] chr4 (1 HSPs)
chr4 (1-40)||(1193790-1193829)
[»] chr3 (1 HSPs)
chr3 (381-423)||(45635099-45635141)


Alignment Details
Target: chr4 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 1193829 - 1193790
Alignment:
1 acaaaagaaacaggataatgcaagatttcttagattacta 40  Q
    ||||||||||||||||||||||||||||||||||||||||    
1193829 acaaaagaaacaggataatgcaagatttcttagattacta 1193790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 381 - 423
Target Start/End: Original strand, 45635099 - 45635141
Alignment:
381 gttgcaagagttggcagtgccatgttgatggttaaaaagaagc 423  Q
    |||||||| |||||||||||||||||||| | |||||||||||    
45635099 gttgcaagggttggcagtgccatgttgattgctaaaaagaagc 45635141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University