View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0249_high_9 (Length: 266)
Name: NF0249_high_9
Description: NF0249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0249_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 34 - 243
Target Start/End: Original strand, 31055513 - 31055722
Alignment:
| Q |
34 |
gatgaatcaccaatgttctctctcaagctattgttaagaaaattgagcttaaagcagataattgaaaccaagaaaaacggtctaacatgtctttttcatt |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31055513 |
gatgaatcaccaatgttctctctcaagctattgttaagaaaattgagcttaatgcagataattgaaaccaagaaaaacggtctaacacgtctttttcatt |
31055612 |
T |
 |
| Q |
134 |
ataaacttgcagaatacaaaatattgctaccttttaaaatattatggtgccatttgatctatgaccgaccacctttagtgggataaggtttgattgttat |
233 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31055613 |
ataaacttgcagaatacaaaatatggctaccttttaaaacattatggtgtcatttgatctatgaccgaccacctttagtgggataaggtttggttgttat |
31055712 |
T |
 |
| Q |
234 |
cgagtataat |
243 |
Q |
| |
|
|||||||||| |
|
|
| T |
31055713 |
cgagtataat |
31055722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University