View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0249_low_1 (Length: 391)
Name: NF0249_low_1
Description: NF0249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0249_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 1 - 369
Target Start/End: Original strand, 15288543 - 15288911
Alignment:
Q |
1 |
gcgttgaagcagttacagcggttacgagacggtggttgaagttgcggttgcggttgttcttccatgaaactctgaaccattttcgccaagcaaacagagc |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
15288543 |
gcgttgaagcagttacagcggttacgagacggtggttgaagttgcggttgcggttgttcttccatgaaactttgaaccattttcgccaagcaaacagagc |
15288642 |
T |
 |
Q |
101 |
ttggttccaactcagcaactccaccagcaccatctttagtggtattgttcttcggaaaaggtttctcgaaagcgaaaaacctcttcaacctccatttcga |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
15288643 |
ttggttccaactcagcaactccaccagcaccatctttagtggtattgttcttcggaaaaggtttctcgaaagcgaaaaacctcttcaacctccacttcga |
15288742 |
T |
 |
Q |
201 |
aactggttcatttcgaaccagttccgtagtggctttctctgaatctatgtcaatcggttggatcttcaacggagccgttaatcttcttctcaaacaacaa |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
T |
15288743 |
aactggttcatttcgaaccagttccgtagtggctttctctgaatctatgtcaatcggttggatcttcaacggagccattaatcttcttctcaaacaagaa |
15288842 |
T |
 |
Q |
301 |
aaatgctagctttaaattgaagagtcaaaattacaagctagtcaacaaagtcaataactcatagtcaca |
369 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15288843 |
aaatgctagctttaaattgaagagtcaaaattacaagctagtcaacaaagtcaataactcatagtcaca |
15288911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1494 times since January 2019
Visitors: 2391