View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0249_low_11 (Length: 287)
Name: NF0249_low_11
Description: NF0249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0249_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 38 - 240
Target Start/End: Complemental strand, 31454892 - 31454690
Alignment:
| Q |
38 |
ttggcaaactaattgatcttaatggttgatgagtagatggtaacattgaaattgtttccatttttcttcttcttcttttgttgtttacttagaagtgcaa |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31454892 |
ttggcaaactaattgatcttaatggttgatgagtagatggtaacattgaaattgtttccattttttttcttcttcttttgttgtttacttagaagtgcaa |
31454793 |
T |
 |
| Q |
138 |
taaaacaagggttaaatgttgcttgttttgcaattagtgtttcttcaatctatttataggaatgtggtaaaagagaattatagaaatttaattatttgag |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31454792 |
taaaacaagggttaaatgttgcttgttttgcaattagtgtttcttcaatctatttataggaatgtggtaaaagagaattatagaaatttaattatttgag |
31454693 |
T |
 |
| Q |
238 |
tat |
240 |
Q |
| |
|
||| |
|
|
| T |
31454692 |
tat |
31454690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University