View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0249_low_13 (Length: 266)

Name: NF0249_low_13
Description: NF0249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0249_low_13
NF0249_low_13
[»] chr6 (1 HSPs)
chr6 (34-243)||(31055513-31055722)


Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 34 - 243
Target Start/End: Original strand, 31055513 - 31055722
Alignment:
34 gatgaatcaccaatgttctctctcaagctattgttaagaaaattgagcttaaagcagataattgaaaccaagaaaaacggtctaacatgtctttttcatt 133  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||    
31055513 gatgaatcaccaatgttctctctcaagctattgttaagaaaattgagcttaatgcagataattgaaaccaagaaaaacggtctaacacgtctttttcatt 31055612  T
134 ataaacttgcagaatacaaaatattgctaccttttaaaatattatggtgccatttgatctatgaccgaccacctttagtgggataaggtttgattgttat 233  Q
    |||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||    
31055613 ataaacttgcagaatacaaaatatggctaccttttaaaacattatggtgtcatttgatctatgaccgaccacctttagtgggataaggtttggttgttat 31055712  T
234 cgagtataat 243  Q
    ||||||||||    
31055713 cgagtataat 31055722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2520 times since January 2019
Visitors: 2401