View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0249_low_17 (Length: 245)
Name: NF0249_low_17
Description: NF0249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0249_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 9 - 194
Target Start/End: Original strand, 3959196 - 3959381
Alignment:
| Q |
9 |
cttacactcttcattgcagcagtactatgattgtttacctggtcttcatctctagcaacatgggcagtagccgtgtccatctgtgatactgcaaccttat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3959196 |
cttacactcttcattgcagcagtactatgattgtttacctggtcttcatctctagcaacatgggcagtagccgtgtccatctgtgatactgcaactttat |
3959295 |
T |
|
| Q |
109 |
ctgccagttgggaacatcccacatcagcctctttgtttgcttgaatgctgactaaattttgatactctgttgaggtgtcatctctg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3959296 |
ctgccagttgggaacatcccacatcagcctctttgtttgcttgaatgctgactaaattttgatactctgttgaggtgtcatctctg |
3959381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 19167998 - 19167816
Alignment:
| Q |
12 |
acactcttcattgcagcagtactatgattgtttacctggtcttcatctctagcaacatgggcagtagccgtgtccatctgtgatactgcaaccttatctg |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||||||| |||||||||| |||||||| |||||||| |||| || |
|
|
| T |
19167998 |
acactcttcattgcagcagtactaggattgtttacctgatcttcatatctagcaacatgggcaatagccgtgtcaatctgtgaaactgcaactttatttg |
19167899 |
T |
|
| Q |
112 |
ccagttgggaacatcccacatcagcctctttgtttgcttgaatgctgactaaattttgatactctgttgaggtgtcatctctg |
194 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| | || ||||||||||||| ||||||||||| | ||||||||||| |
|
|
| T |
19167898 |
ccaattgggaacatcccacatcagcctctttgtttgcctaaaggctgactaaatttagatactctgttaaactgtcatctctg |
19167816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2267 times since January 2019
Visitors: 2400