View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0249_low_20 (Length: 234)

Name: NF0249_low_20
Description: NF0249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0249_low_20
NF0249_low_20
[»] chr4 (1 HSPs)
chr4 (72-224)||(45565524-45565676)
[»] chr8 (1 HSPs)
chr8 (153-185)||(45286940-45286972)


Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 72 - 224
Target Start/End: Complemental strand, 45565676 - 45565524
Alignment:
72 tttctttgaagtgtgcttggaggtattcttcctactcttatgagacttcaagagagaggagttctatgttcaaatggatgtccccattgtgaaacaaact 171  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||    
45565676 tttctttgaagtgtgcttggaggtattcttcctactcttatgagacttcaaaagagaggagttccatgttcaaatggatgtccccattgtgaaacaaact 45565577  T
172 atgagaacgattggatgtaaagcggcaaaacaaatatggtgcgaggctgatct 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
45565576 atgagaacgattggatgtaaagcggcaaaacaaatatggtgcgaggctgatct 45565524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 185
Target Start/End: Original strand, 45286940 - 45286972
Alignment:
153 ccccattgtgaaacaaactatgagaacgattgg 185  Q
    |||||||||||||||||||| ||||||||||||    
45286940 ccccattgtgaaacaaactacgagaacgattgg 45286972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University