View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0250-INSERTION-3 (Length: 194)
Name: NF0250-INSERTION-3
Description: NF0250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0250-INSERTION-3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 7 - 169
Target Start/End: Complemental strand, 47137282 - 47137120
Alignment:
| Q |
7 |
atggtggtgactaaatttcatgtggattgctttgatcagggtctatgcaccggtgtggttattttgtggataagtggtggtaaaagctcgcatctactag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47137282 |
atggtggtgactaaatttcatgtggattgctttgatcagggtctatgcaccggtgtggttattttgtggataagtggtggtaaaagctcgcatctactag |
47137183 |
T |
|
| Q |
107 |
tttttagtgaagatcnnnnnnnnatatatcttctacctcccatcatctttaatgccgggtaat |
169 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47137182 |
tttttagtgaagatcttttttttatatatcttctacctcccatcatctttaatgccgggtaat |
47137120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1081 times since January 2019
Visitors: 2388