View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0250_high_3 (Length: 269)
Name: NF0250_high_3
Description: NF0250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0250_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 36172118 - 36172380
Alignment:
Q |
1 |
atgtgtcaagtgtatgacattggcatgtgtttgagtaccaaagacgtcttcactctgaagtgtttgtgctacataaatggcataaataccttgtttgttg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
36172118 |
atgtgtcaagtgtatgacattggcatgtgtttgagtaccaaagacgtcttcactctgaagtgtttgtgctacataaatggcatagataccttgtttgttg |
36172217 |
T |
 |
Q |
101 |
gggaggagagaaaagcctcaggagctccgtcactccactcactgcaatcttcagaacctgaggggtttcgtttttctctcttaccatgttataaattgca |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36172218 |
gggaggagagaaaagcctcaggagctccgtcactccactcactgcaatcttcagaacctgaggggtttcgtttttctctcttaccatgttataaattgca |
36172317 |
T |
 |
Q |
201 |
caagtgtttctgctactcggtgtgtaactgtttgagcagtgttgtttccgcaacagctagggc |
263 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
T |
36172318 |
caagtgtttctgctactcggtgtgtaactgtttgagcagtgttgtttccgcaactgcaagggc |
36172380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2116 times since January 2019
Visitors: 2396