View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0250_low_11 (Length: 206)
Name: NF0250_low_11
Description: NF0250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0250_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 40748931 - 40749060
Alignment:
| Q |
1 |
atgtccgatgtccagcacatatgatttgtctaatataacatcgacacaatgctgacacaaacagttacattaaatcgcttttttaaaattagagtgaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
40748931 |
atgtccgatgtccagcacatatgatatgtctaatataacatcgacacaatgctgacacaaacagttacattaaatcgcattttttaaattagagtgaaga |
40749030 |
T |
|
| Q |
101 |
cacaatttggtttctcacaattttctctcg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40749031 |
cacaatttggtttctcacaattttctctcg |
40749060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2498 times since January 2019
Visitors: 2401