View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| ||||||||||||||||
Alignment Overview
Query: NF0250_low_6 (Length: 315)
Name: NF0250_low_6
Description: NF0250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| |||||
| ||||||
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 81 - 206
Target Start/End: Original strand, 31296814 - 31296939
Alignment:
| Q | 81 | tgaatgctaatcatgttggtattaatctaggaagtcttgtatctgttgctgttgcaaatgtttctaaatcgaatttggttttgaatagtggtgaaaagtt | 180 | Q |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||
| T | 31296814 | tgaatgctaatcatgttggtattaatctaggaagtcttgtatctgttgctgttgcaaatgtttctaaatcgaatttggttttgaatagtggtgaaaagtt | 31296913 | T |
 | ||||
| Q | 181 | gaaatcttgggttgattatgataatg | 206 | Q |
| |||||||||||||||||||||||||| | ||||
| T | 31296914 | gaaatcttgggttgattatgataatg | 31296939 | T |
| ||||
Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 190
Target Start/End: Complemental strand, 13358527 - 13358460
Alignment:
| Q | 122 | tctgttgctgttgcaaatgtttctaaatcgaatttggttttgaatagtggtgaaaagttgaaatcttgg | 190 | Q |
| ||||||| ||||||||| ||||| |||| |||||||||| || |||| |||||||| ||||||||||| | ||||
| T | 13358527 | tctgttgttgttgcaaa-gtttcaaaatagaatttggttctggatagctgtgaaaagatgaaatcttgg | 13358460 | T |
| ||||
Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4900 times since January 2019Visitors: 8866