View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0250_low_6 (Length: 315)

Name: NF0250_low_6
Description: NF0250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0250_low_6
NF0250_low_6
[»] chr3 (2 HSPs)
chr3 (81-206)||(31296814-31296939)
chr3 (122-190)||(13358460-13358527)


Alignment Details
Target: chr3 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 81 - 206
Target Start/End: Original strand, 31296814 - 31296939
Alignment:
81 tgaatgctaatcatgttggtattaatctaggaagtcttgtatctgttgctgttgcaaatgtttctaaatcgaatttggttttgaatagtggtgaaaagtt 180  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31296814 tgaatgctaatcatgttggtattaatctaggaagtcttgtatctgttgctgttgcaaatgtttctaaatcgaatttggttttgaatagtggtgaaaagtt 31296913  T
181 gaaatcttgggttgattatgataatg 206  Q
    ||||||||||||||||||||||||||    
31296914 gaaatcttgggttgattatgataatg 31296939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 190
Target Start/End: Complemental strand, 13358527 - 13358460
Alignment:
122 tctgttgctgttgcaaatgtttctaaatcgaatttggttttgaatagtggtgaaaagttgaaatcttgg 190  Q
    ||||||| ||||||||| ||||| |||| |||||||||| || ||||  |||||||| |||||||||||    
13358527 tctgttgttgttgcaaa-gtttcaaaatagaatttggttctggatagctgtgaaaagatgaaatcttgg 13358460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4900 times since January 2019
Visitors: 8866