View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0250_low_7 (Length: 293)

Name: NF0250_low_7
Description: NF0250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0250_low_7
NF0250_low_7
[»] chr8 (1 HSPs)
chr8 (27-197)||(36885031-36885202)


Alignment Details
Target: chr8 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 27 - 197
Target Start/End: Original strand, 36885031 - 36885202
Alignment:
27 tatcataggctaaatttgtaagttctgaatcctatctcacagccattttagtagctgaggtggggaggacaaaactaaaaagtattgttttg-tttttta 125  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
36885031 tatcataagctaaatttgtaagttctgaatcctatctcacagccattttagtagctgaggtggggaggacaaaactaaaaagtattgttttgttttttta 36885130  T
126 aaagtattgtgcgtagtgtctaaatagaaaacttttgtcgttgaagaacataatccctgtcaatgaaaatag 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
36885131 aaagtattgtgcgtagtgtctaaatagaaaacttttgtcgttgaagaacgtaatccctgtcaatgaaaatag 36885202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2095 times since January 2019
Visitors: 2396