View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253-INSERTION-1 (Length: 281)
Name: NF0253-INSERTION-1
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0253-INSERTION-1 |
 |  |
|
| [»] scaffold1432 (1 HSPs) |
 |  |  |
|
| [»] scaffold0236 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1432 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: scaffold1432
Description:
Target: scaffold1432; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 6 - 280
Target Start/End: Complemental strand, 1684 - 1412
Alignment:
| Q |
6 |
caaattaaatgtcttttaactctttataaaatatctctgcattgttggtgaatttatgatttccttgttattttgctttgctttattttagtagtttgta |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1684 |
caaattaaatgtcttttaactctttataaaatatctctgcatttttggtgaatttatgatttccttgttattttgctttgctttattttagtagtttgta |
1585 |
T |
 |
| Q |
106 |
tcgggtgtgtttggtatttgaaagtgacttggtttagtagtacagtattttgagtaattggattatagcggctttagctaaattcagcatcctcaattgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1584 |
tcgggtgtgtttggtatttgaaagtgacttggtttagtagtacagtattttgagtaattggattatagcggctttagctaaattcagcatcctc--ttgg |
1487 |
T |
 |
| Q |
206 |
ccttacaagtaaaatttctaacaataaaaataaccgaaccctatcctttctcaatctctgctcttccattttctt |
280 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
1486 |
ccttacaagtaaaatttcaaacaataaaaataaccgaaccctatcctctctcaatctctgctcttccattctctt |
1412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0236 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 45 - 279
Target Start/End: Original strand, 21733 - 21960
Alignment:
| Q |
45 |
cattgttggtgaatttatgatttccttgttattttgctttgctttattttagtagtttgtatcgggtgtgtttggtatttgaaagtgacttggtttagta |
144 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
21733 |
cattgttggtgattttatgatttccttgttattttgctttgctttattttagtagtttgtatcgggtgtgtttggtatttgaaagtgatttggtttact- |
21831 |
T |
 |
| Q |
145 |
gtacagtattttgagtaattggattatagcggctttagctaaattcagcatcctcaattggccttacaagtaaaatttctaacaataaaaataaccgaac |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
21832 |
----agtattttgagtaattggattatagcggctttagctaaattcaccatcctc--ttggccttacaagtaaaatttcaaacaataaaaataactgaac |
21925 |
T |
 |
| Q |
245 |
cctatcctttctcaatctctgctcttccattttct |
279 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||| |
|
|
| T |
21926 |
cctagtctttctcaatctctgatcttccattttct |
21960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University