View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253-INSERTION-12 (Length: 211)
Name: NF0253-INSERTION-12
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0253-INSERTION-12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 1e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 50 - 183
Target Start/End: Complemental strand, 35443146 - 35443013
Alignment:
| Q |
50 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35443146 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg |
35443047 |
T |
|
| Q |
150 |
gtttgtttggttgcaaaatgctaaaaatacatat |
183 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
35443046 |
gtttgtttggttacaaaatgctaaaaatacatat |
35443013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 35443257 - 35443205
Alignment:
| Q |
1 |
tgcgaaaataaacaaaggaatcacctttgttctttacctt-ttttatgtttgt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35443257 |
tgcgaaaataaacaaaggaatcacctttgttctttacctttttttatgtttgt |
35443205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 211
Target Start/End: Complemental strand, 30803759 - 30803731
Alignment:
| Q |
183 |
tgtgatgtcaacattcttctcctaacctc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30803759 |
tgtgatgtcaacattcttctcctaacctc |
30803731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 211
Target Start/End: Original strand, 42624101 - 42624129
Alignment:
| Q |
183 |
tgtgatgtcaacattcttctcctaacctc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42624101 |
tgtgatgtcaacattcttctcctaacctc |
42624129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 446 times since January 2019
Visitors: 2566