View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0253-INSERTION-12 (Length: 211)

Name: NF0253-INSERTION-12
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0253-INSERTION-12
NF0253-INSERTION-12
[»] chr7 (2 HSPs)
chr7 (50-183)||(35443013-35443146)
chr7 (1-52)||(35443205-35443257)
[»] chr5 (1 HSPs)
chr5 (183-211)||(30803731-30803759)
[»] chr1 (1 HSPs)
chr1 (183-211)||(42624101-42624129)


Alignment Details
Target: chr7 (Bit Score: 130; Significance: 1e-67; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 50 - 183
Target Start/End: Complemental strand, 35443146 - 35443013
Alignment:
50 tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg 149  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35443146 tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg 35443047  T
150 gtttgtttggttgcaaaatgctaaaaatacatat 183  Q
    |||||||||||| |||||||||||||||||||||    
35443046 gtttgtttggttacaaaatgctaaaaatacatat 35443013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 35443257 - 35443205
Alignment:
1 tgcgaaaataaacaaaggaatcacctttgttctttacctt-ttttatgtttgt 52  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||    
35443257 tgcgaaaataaacaaaggaatcacctttgttctttacctttttttatgtttgt 35443205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 211
Target Start/End: Complemental strand, 30803759 - 30803731
Alignment:
183 tgtgatgtcaacattcttctcctaacctc 211  Q
    |||||||||||||||||||||||||||||    
30803759 tgtgatgtcaacattcttctcctaacctc 30803731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 211
Target Start/End: Original strand, 42624101 - 42624129
Alignment:
183 tgtgatgtcaacattcttctcctaacctc 211  Q
    |||||||||||||||||||||||||||||    
42624101 tgtgatgtcaacattcttctcctaacctc 42624129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University