View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253_high_21 (Length: 247)
Name: NF0253_high_21
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0253_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 14 - 238
Target Start/End: Original strand, 37484228 - 37484452
Alignment:
| Q |
14 |
atctaagctcattctttccctaaaaaagaagagtcccaagggggatgtggaccctacaagtgagcataaatactgactcccaatgagtgttgagttgtgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37484228 |
atctaagctcattctttccctaaaaaagaagagtcccaagggggatgtggaccctacaagtgagcataaatactgactcccaatgagtgttgagttgtgg |
37484327 |
T |
 |
| Q |
114 |
cctgtcttctgttcnnnnnnnnnnnnnctaagtaacgtgctctctttgatcattctcgaggaacaacctcatagtgtcgacatggttggcaaggaagatc |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37484328 |
cctgtcttctgttctgtgtgcgtgtgtctaagtaacgtgctttctttgatcattctcgaggaacaacctcatagtgtcgacatggttggcaaggaagatc |
37484427 |
T |
 |
| Q |
214 |
tattgatcgaagaagtatgcaaact |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37484428 |
tattgatcgaagaagtatgcaaact |
37484452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University