View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253_high_29 (Length: 206)
Name: NF0253_high_29
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0253_high_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 13610331 - 13610205
Alignment:
| Q |
1 |
acttgaaagaaaattgagacttcctgagaaattcaaatcacacagcttgagcaatttaaggcgagtcatctttgctaaagcttcagccctcaatgttgtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13610331 |
acttgaaagaaaattgagacttcctgagaaattcaaatcacgcagcttgagcaatttaaggcgagtcatctttgctaaagcttcagccctcaatgttgtc |
13610232 |
T |
 |
| Q |
101 |
attgcttctacttcagccttatattct |
127 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
13610231 |
attgcttctacttcagccttattttct |
13610205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 5 - 102
Target Start/End: Complemental strand, 31246273 - 31246176
Alignment:
| Q |
5 |
gaaagaaaattgagacttcctgagaaattcaaatcacacagcttgagcaatttaaggcgagtcatctttgctaaagcttcagccctcaatgttgtcat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||| | |||||||||||||| |||||||||||||| |
|
|
| T |
31246273 |
gaaagaaaattgagacttcctgagaaattcaaattccacagcatgagcaatttaaggcgactcatttgtgctaaagcttcagttctcaatgttgtcat |
31246176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University