View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253_high_6 (Length: 394)
Name: NF0253_high_6
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0253_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 9e-80; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 9e-80
Query Start/End: Original strand, 66 - 253
Target Start/End: Complemental strand, 29282048 - 29281853
Alignment:
Q |
66 |
taaaccttgattgttgatattaaaggcatgtgtgtgtgagcaagatttgtgattggagttgaacagggctatgaaagtaacaacgattttagtgtcatcg |
165 |
Q |
|
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29282048 |
taaaccctgattgttgatattaaaggcatgtgtgggtgagcaagatttgtgattggagttgaacagggctatgaaagtaacaacgattttagtgtcatcg |
29281949 |
T |
 |
Q |
166 |
aatcatacttgagagttcca--------agtgttatttattactatcctttttctctttcagccgccatatataacacacccttgtatctcatgta |
253 |
Q |
|
|
|||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29281948 |
aatcatacttgagagtccaaggattgttagtgttatttattactatcctttttctctttcagccgccatatataacacacccttgtatctcatgta |
29281853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 29281807 - 29281774
Alignment:
Q |
299 |
atagtatctagcaagaacaagatagaaaatcacc |
332 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
29281807 |
atagtatctagcaagaacaagatagaaaatcacc |
29281774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 58
Target Start/End: Complemental strand, 29282073 - 29282045
Alignment:
Q |
30 |
ttggacacctccatcttttgagaaataaa |
58 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
29282073 |
ttggacacctccatcttttgagaaataaa |
29282045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University