View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253_low_17 (Length: 345)
Name: NF0253_low_17
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0253_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 82 - 289
Target Start/End: Complemental strand, 39893055 - 39892848
Alignment:
Q |
82 |
ggagcagagaaggcatggttattgagtgcttgttgaatgagattttgaagctcttggagtgagttgttttcattgtttggaatattatcagaaggtttgt |
181 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39893055 |
ggagcagagaaggcatggttattgaatgcttgttgaatgagattttgaagctcttggagtgagttgttttcattgtttggaatattatcagaaggtttgt |
39892956 |
T |
 |
Q |
182 |
tgaaagtttgttcttgttcggtattaggtttggagagatgagattgaagagtgacagggttgtttatcttctgaggttgagggtgtgaatctaagggttg |
281 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
T |
39892955 |
tgaaagtttgttcttgttcggtattaggtttggagagatgagattgaagagtgacagggttgtttttcttctgaggttgagggtgtgaatataagggttg |
39892856 |
T |
 |
Q |
282 |
tggaacat |
289 |
Q |
|
|
|||||||| |
|
|
T |
39892855 |
tggaacat |
39892848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University