View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0253_low_23 (Length: 322)

Name: NF0253_low_23
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0253_low_23
NF0253_low_23
[»] chr3 (3 HSPs)
chr3 (149-244)||(21733160-21733255)
chr3 (149-244)||(21741661-21741756)
chr3 (159-239)||(21748683-21748763)
[»] chr1 (1 HSPs)
chr1 (152-219)||(30148053-30148120)


Alignment Details
Target: chr3 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 149 - 244
Target Start/End: Original strand, 21733160 - 21733255
Alignment:
149 cgagtttataatgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatatt 244  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21733160 cgagtttataatgaagctttctcttttgatccttttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatatt 21733255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 149 - 244
Target Start/End: Original strand, 21741661 - 21741756
Alignment:
149 cgagtttataatgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatatt 244  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
21741661 cgagtttataatgaagctttctcttttgatccttttctttttgtctctcctcattagctcttctagcagtgagtttcttctcttctattgcatatt 21741756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 159 - 239
Target Start/End: Original strand, 21748683 - 21748763
Alignment:
159 atgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgc 239  Q
    |||||||| ||||||||||||||||||||| ||||||||||  ||||||| ||  ||||||||| ||||||||||||||||    
21748683 atgaagctatctcttttgatcattttctttgtgtctctcctggttagctcatcgtgcagtgagtatcttctcttctattgc 21748763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 152 - 219
Target Start/End: Complemental strand, 30148120 - 30148053
Alignment:
152 gtttataatgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtg 219  Q
    ||||||||||||||||||| ||||||||||||||| | |||||| |||||||||||| || |||||||    
30148120 gtttataatgaagctttctattttgatcattttctctgtgtctcccctaattagctcatcaagcagtg 30148053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 741 times since January 2019
Visitors: 2568