View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253_low_26 (Length: 321)
Name: NF0253_low_26
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0253_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 148 - 243
Target Start/End: Original strand, 21733160 - 21733255
Alignment:
Q |
148 |
cgagtttataatgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatatt |
243 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21733160 |
cgagtttataatgaagctttctcttttgatccttttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatatt |
21733255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 148 - 243
Target Start/End: Original strand, 21741661 - 21741756
Alignment:
Q |
148 |
cgagtttataatgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatatt |
243 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21741661 |
cgagtttataatgaagctttctcttttgatccttttctttttgtctctcctcattagctcttctagcagtgagtttcttctcttctattgcatatt |
21741756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 21748683 - 21748763
Alignment:
Q |
158 |
atgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgc |
238 |
Q |
|
|
|||||||| ||||||||||||||||||||| |||||||||| ||||||| || ||||||||| |||||||||||||||| |
|
|
T |
21748683 |
atgaagctatctcttttgatcattttctttgtgtctctcctggttagctcatcgtgcagtgagtatcttctcttctattgc |
21748763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 151 - 218
Target Start/End: Complemental strand, 30148120 - 30148053
Alignment:
Q |
151 |
gtttataatgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtg |
218 |
Q |
|
|
||||||||||||||||||| ||||||||||||||| | |||||| |||||||||||| || ||||||| |
|
|
T |
30148120 |
gtttataatgaagctttctattttgatcattttctctgtgtctcccctaattagctcatcaagcagtg |
30148053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 598 times since January 2019
Visitors: 2567