View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253_low_29 (Length: 318)
Name: NF0253_low_29
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0253_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 96 - 249
Target Start/End: Original strand, 13271044 - 13271197
Alignment:
| Q |
96 |
ataaaagattcacattctctatgattgatctctgatggacatcagtatattcgctgaacatctcaaatcctcccatcatcatatagttgccaaattgttc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13271044 |
ataaaagattcacattctctatgattgacctctgatggacatcagtatattcactcgacatctcaaatgctcccatcatcatatagttgccaaattgttc |
13271143 |
T |
 |
| Q |
196 |
caaaacatttccaccttcacttggtgtagcaagatgcaattcaagatattcttc |
249 |
Q |
| |
|
||||||| |||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
13271144 |
caaaacaattccactttcagttggtgtagcaagattcaattcaagatattcttc |
13271197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University