View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0253_low_38 (Length: 265)

Name: NF0253_low_38
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0253_low_38
NF0253_low_38
[»] chr3 (1 HSPs)
chr3 (39-163)||(3811046-3811170)


Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 39 - 163
Target Start/End: Complemental strand, 3811170 - 3811046
Alignment:
39 ctgtgaagcgtgaggttatgcatgtgctgaagatgtgtttcaatggaacatagctcattaatgtaattttcatggatattgataacttcaaccgataaca 138  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
3811170 ctgtgaagcgtgaggttatgcatgtgctgaagatgtgtttcaatggaatatagctcattaatgtaattttcatggatattgataacttcaaccgataaca 3811071  T
139 aacccttttaagagtaatgaatttg 163  Q
    |||||||||||||||||||||||||    
3811070 aacccttttaagagtaatgaatttg 3811046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University